Name: GSM6583421
Instrument: Illumina HiSeq 2500
Strategy: ncRNA-Seq
Source: TRANSCRIPTOMIC
Selection: size fractionation
Layout: SINGLE
Construction protocol: Either ovaries or embryos were collected for the RNA extraction. Ovaries were dissected from 3 -7 days old female flies. Embryos were collected between zero to two hours after fertilisation. Embryos were further dechorionated by 20% bleach and further rinsed by water. Total RNA was extracted from ovaries/embryos using TRIZOL. For oxidised small RNA libraries: Small RNAs were first size-selected by 12% w/v UREA-PAGE, and oxidised using sodium periodate. For non-oxidised small RNA libraries: 2S rRNA was first removed from the total RNA using a biotinylated DNA ligo 'TACAACCCTCAACCATATGTAGTCCAAGCA'. 2S-rRNA-depleted total RNA was then size-selected by 12% w/v UREA-PAGE to yield the pool of small RNA. The oxidised or unoxidised small RNAs were further size-selected by PAGE before 3' and 5' adapters were ligated. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the library was amplified using KAPA LongRange DNA polymerase (Sigma) with TruSeq compatible primers.